Python #5: Modyfikujemy napisy

W poprzednim wpisie omówiliśmy typy i zmienne, w tym typ String. Jeszcze chwilę uwagi poświęcimy tekstom i ich modyfikowaniu – jest to temat łatwy i przyjemny, obiecuję 😉

Ten wpis jest częścią cyklu kurs Pythona dla początkujących

Napisy jako typ sekwencyjnym

Typ sekwencyjny (złożony) oznacza, że w jednej zmiennej możemy przechować wiele wartości (w przeciwieństwie do typów prostych, które mogą przechowywać tylko jedną wartość np. int).
Jeden napis (łańcuch znaków) może zawierać wiele znaków.

>>> napis1="ciasto czekoladowe"
>>> napis2="babeczki truskawkowe"

Aby sprawdzić ile znaków zawiera łańcuch możemy „zmierzyć” jego długość funkcją len().

>>> len(napis1)
18
>>> len(napis2)
20
>>> len(napis1+napis2)
38
>>> len(napis1)+len(napis2)
38

Jaka różnica jest między przedostatnim i ostatnim sprawdzeniem.

Typ sekwencyjny pozwala na dostęp do każdego swojego elementu z osobna – analogicznie jak w poznanych do tej pory listach i krotkach.

Kolejne elementy – znaki numerowane są od 0.

>>> txt="hello"
>>> txt[0]
h
>>> txt[1]
e
>>> txt[2]+txt[3]
ll

Jednocześnie możemy cofać się po elementach napisu. Elementem o indeksie [-1] będzie ostatni znak w łańcuchu.

>>> txt[-1]
o
>>> txt[-2]
l
>>> txt[-3]
l

Python String - indeksy

Co się stanie jeśli spróbujemy dostać się do elementu, który nie istnieje np. txt[5] czy txt[-6]?

IndexError: string index out of range

Python wyrzuca nam prosty komunikat o wyjściu poza zakres.

Załóżmy, że w wyrazie hello, chcemy zamienić e na literę a.
Może wystarczy zapisać txt[1] = 'a'? Nie, to nie zadziała.
Stringi w Pythonie są niemutowalne (niezmienne)! (Skojarzenie z krotkami z poprzedniego wpisu, jest jak najbardziej na miejscu).
Rozwiązać, można to np. txt = txt[0] + 'a' + txt[2:].

To nie koniec rzeczy, które możemy zrobić dzięki temu, że napis jest sekwencją znaków. String slicing pozwala na wycięcie części napisu i zwrócenie jako nowy napis. Do tej pory każda pojedynczo wyciągnięta litera stawała się nowym 1 elementowym napisem, teraz możemy wyciąć kawałek dowolnej wielkości.

>>> txt[1:4]
ell
>>> napis1[4:10]
to cze

Przyjrzyj się uważnie jak zostały wycięte znaki. Od pozycji [1] do pozycji 4, ale bez uwzględnienia znaku na miejscu [4]. Tak samo dla napisu drugiego, zostały wycięte znaki od [4] (czyli znaku piątego, gdyż liczymy od zera) do znaku 10, ale bez znaku na miejscu [10].

>>> txt[1:] #zwraca od pos 1 do końca
ello
>>> napis1[:10] #zwraca od początku do pos 10
ciasto cze

Metody klasy String

Python posiada zbiór metod, za pomocą, których możecie łatwo modyfikować napisy. Podzieliłam je dla was na tabele wg tego co zwracają, dzięki czemu nauka powinna być łatwiejsza, a w razie potrzeby szybko znajdziecie potrzebną wam metodę (a gwarantuję jeszcze nie raz się przydadzą 😉 ).
Metod używamy na stringu (napisie) według wzoru string.metoda(), z wyjątkiem metod – len, max, min, które string przymują wewnątrz metody.

Metody zwracające nowy napis (string):

Metoda Znaczenie
lower() Zmienia wszystkie duże litery na małe w stringu
upper() Zmienia wszystkie małe litery na duże w stringu
swapcase() Odwraca rodzaj każdej litery – małe na duże, duże na małe
capitalize() Zmienia pierwszą literę w ciągu na dużą
title() Zwraca string – tytuł, w którym wszystkie wyrazy zaczynają się dużą literą, a reszta jest małymi lub są to znaki nieliterowe
join(seq) Łączenie (konkatenacja) wyrazów w napisie seq w jeden napis, według separatora/stringu na jakim wywołujemy metodę
lstrip() Usuwa białe znaki z początku napisu – zwraca kopię pozbawioną białych znaków od lewej strony
rstrip() Usuwa białe znaki z końca napisu – zwraca kopię pozbawioną białych znaków od prawej strony
strip([chars]) Usuwa białe znaki lub znak podanny jako char z początku i końca napisu – wykonuje lstrip() i rstrip() na napisie.
max(string) Zwraca literę znajdującą się najdalej w alfabecie od A
min(string) Zwraca literę znajdującą się najbliżej w alfabecie od A
split(str="", num=string.count(str)) Dzieli łańcuch według separatora str (spacja jeśli nie podano) i zwraca podciągi jako listę lub podzieli na co najwyżej liczbę podciągów, jeśli podano num
splitlines( num=string.count('n')) Dzieli cały łańcuch (lub wg zadanej liczby num) na osobne linie wg znaku nowej linii’\n’ i zwraca je jako tablicę
replace(old, new [, max]) Zamienia wszystkie wystąpienia ciagu old na ciąg new lub jeśli jest podane max – podmiana zostanie wykonana o wskazaną liczbę wystąpień

Przykłady użycia:

>>> text = "ala ma morsa"
ala ma kota
>>> text.upper()
ALA MA MORSA
>>> "*".join("abrakadabra")
a*b*r*a*k*a*d*a*b*r*a
>>> "abrakadabra".strip("a")
brakadabr
>>> text.replace(" ","-")
ala-ma-morsa

Metody zwracające wartość liczbową:

Metoda Znaczenie
len(string) Zwraca długość ciągu znaków
count(str, beg=0,end=len(string)) Zlicza ile razy zadany ciąg znaków(str) wystąpił w ciągu znaków lub wewnątrz podciągu, który zaczyna się od indeksu beg i kończy indeksem end
find(str, beg=0 end=len(string)) Sprawdza gdzie ciąg str występuje w napisie lub podciągu tego napisu jeśli podamy indexbeg i indeks końcowy end. Zwraca indeks początkowy lub -1 jeśli ciąg str nie znajduje się w napisie
rfind(str, beg=0,end=len(string)) Działa jak find(), ale wyszukiwanie od końca ciągu znaków
index(str, beg=0, end=len(string)) Działa jak find(), ale zwraca wyjątek jeśli ciąg str nie zostanie znaleziony
rindex( str, beg=0, end=len(string)) Działa jak index(), ale wyszukiwanie od końca ciągu znaków

Przykłady użycia:

>>> text = "ala ma morsa"
ala ma kota
>>> text.count('a')
4
>>> text.count('a', 3)
2
>>> text.count('a', 3,10)
1
>>> text.find("a ")
2
>>> text.rfind("a ")
5

Metody zwracające true/false:

Metoda Znaczenie
isalnum() Zwraca true jeśli wszystkie znaki w ciągu są alfanumeryczne (litery lub cyfry)
isalpha() Zwraca true jeśli wszystkie znaki w ciągu są literami
isdigit() Zwraca true jeśli wszystkie znaki w ciągu są cyframi
islower() Zwraca true jeśli wszystkie znaki w ciągu są małymi literami.
isspace() Zwraca true jeśli wszystkie znaki w ciągu są białymi znakami (spacja, tabulacja, przejście do nowej linii itp)
istitle() Zwraca true jeśli ciąg spełnia warunek tytułu (każdy wyraz napisu musi zaczynać się dużą literą i składać wyłącznie z małych liter lub znaków nieliterowych)
isupper() Zwraca true jeśli ciąg ma co najmniej jedną dużą literę.
startswith(str, beg=0,end=len(string)) Zwraca wynik sprawdzenia, czy napis jest rozpoczęty ciągiem str. Przy podaniu indeksu beg, sprawdzenie rozpoczyna się od tego znaku. Przy wystąpieniu argumentu end sprawdzenie zakończy się na tym znaku
endswith(str, beg=0, end=len(string)) Zwraca wynik sprawdzenia, czy napis jest zakończony ciągiem str. Przy podaniu indeksu beg, sprawdzenie rozpoczyna się od tego znaku. Przy wystąpieniu argumentu end sprawdzenie zakończy się na tym znaku

Przykład użycia:

>>> text = "ala ma morsa"
ala ma kota
>>> text.isalnum()
True
>>> text.isupper()
False
>>> "Python Jest Fajny".istitle()
True

Polecam przetestować każdą z metod w konsoli, aby przekonać się, że opisy ich działania są zrozumiałe!

Zadanie 1 – rozgrzewka
Podpunktów nie trzeba wykonywać pokolei, jeśli czegoś nie pamietasz – idź dalej. Możesz przeczytać wpis ponownie i wrócić do pozostawionego zadania

Do zmiennej sentence przypisz zdanie: „Kurs Pythona jest prosty i przyjemny.”, a następnie:

  1. Policz wszystkie znaki w napisie
  2. Nie modyfikując zmiennej sentence wyświetl słowo „prosty”
  3. Wyświetl znak o indeksie (czy za każdym razem rozumiesz co się dzieje?):
    • 7
    • 12
    • -4
    • 37
  4. Wprowadź do zdania 2 błędy ortograficzne 😉

Zadanie 2
Utwórz skrypt, który zapyta użytkownika o imię, nazwisko i numer telefonu, a następnie:

  1. Sprawdź czy imię i nazwisko składają się tylko z liter, a nr tel składa się wyłącznie z cyfr (wyświetl tę informację jako true/false)
  2. Użytkownicy bywają leniwi. Nie zawsze zapisują imię czy nazwisko z dużej litery – popraw ich
  3. Niektórzy podają numer telefonu z myślnikami lub z spacjami, usuń zbędne znaki z numeru
  4. Zakładając, że twoi użytkownicy noszą polskie imiona, sprawdź czy użytkownik jest kobietą
  5. Połącz dane w jeden ciąg personal za pomocą spacji
  6. Policz liczbę wszystkich znaków w napisie personal
  7. Podaj liczbę tylko liter w napisie personal

Podpowiedź – weź pod uwagę, że numery telefonów w Polsce są 9-cyfrowe

Zadanie 3*
Łatwiejsze niż się wydaje;

Wyobraź sobie, że jesteś bioinformatykiem i otrzymujesz kod genetyczny do analizy.

Kod DNA składa się z 4 zasad azotowych: adeniny(A), cytozyny(D), guaniny(G), tyminy(T).
Idealny kod DNA wygląda następująco: TGCACGATCATGTCTACTATCCTCTCTATGGTGGGGTT.
Zdarza się, jednak, że kod zawiera małe jak i duże litery. Kolejny problem to maszyny sekwencjonujące nie są wolne od błędów. W zależności od maszyny błędy sekwencjonowania mogą zostać zamienione na znak – czy literę N.

  • W jaki sposób łatwo rozpoznasz, że otrzymany kod DNA zawiera błędy?

Dotarł do ciebie następujący kod genetyczny:

ACTGTGCTGACTCCCGGTGCTGCCGCTGCCATAGCTAAAGCCCGGGTCCTGGTAGGCAGGCGGGAAGCAG
GGTGGGGGTCCCGGGTACTGGTAGGGGTAGCCCTGACCCAGAGGCGGGGGGGCAGCCGGGTGGGGCAGCG
GGGCCAGCGTGTCCTGAA-CGAAGTCCCACTGGAGCCACTGTTGAGGTTCAGGGTGGCGAGATCTGGCGG
NNNAGGGTAGGTGAGGGCCGCGGAGGGGCCTCCGGCGTTCCCCTCCCCCCCGCCCTGAAACCCGAAGCCC
CCACTCACTGCTGCAGAGATCCCCTGAAAACGTAGTAGCACTGCTCgagacAGGTGATCTGTTGACCTGA
AACCGCAGGAAGCCGTGCTTCAGCAAGCTGCTGGCGTACTTCCGGGCCT---GCCGCTCCTTGAAGCCCT
CCACGTGTGTGTACAGCCAGTCCACCACGTCCGCCCCTGGCCGGCACCAGCGGTCAGCCCGCAGCCTCGA
GGCAAGCAGCCCTGCCNNTGGCACTATCCGC-CGCGGGGACGGCCACTCACCGATGACGGCATNNGCGAT
GGTGATCTTGAGCCACATGCGGTCGCGGATCTCCAGTCCCGAG---GGCAGCTGCATGACCCGGACGACG
GCGCTCATGTCACtcaccgtcagcggcgcctcttccagCCAGCTCTGCAAAGCACAGACAGCCCCGCTTC
GCCCCAGCATCTGAAAGCGGGGGACTCggcAcgCTGCACCCCCAGGGGAGCCTCTGGGCAGAGCCTGCGC
CAGGGCGCAAGCTGGACGGTGCGTGACAGCAGGGCCCCGGCCCACTGCAGGATGCACCCCCGTGAGGCTG
GGGCGTGAGCAGGGGGGTTGGACAtttAGTCTCCCACTTCTACAGACACTTTTCATCAGGATCCTAGGCA
CAAACTGGGCTGAAACCCCACCCTGCAGACCAGGAAGTAATGAGAACAGGGCAGGCCCCTTCCCCTCNNC
GCATGCC-CACCCGAGAGCGCAGGCTGTTAGTCGTGTTAATGGCAGGAAGCAGAATGGAGACCTGGCCCC
TGCCTCTGAA-CCGTGGGTGCTCaactggctaGCCCTACGTACATCCCCTGTTCcggCCAACACACAGAC
ATGAGCAGGATGGGCTGCACAAGGTGGGCACGGGTGCCTGTGCACACGTCTGTGCAGGGAGTTGGGGACA
GGCAACACACACGTGTCACAGCCCCATGACGGggcaattgcGCCATGCTGGCTGAATGGCAGAGACGCCC
CTCCAAGCCTCGGTTTCTGCTGGGGCCCTCAGGAGCTGCCACTTACGTGGAGCACCAGGCACGGAGCTGG
TTAGTGAGGAGGAGCTGGTGCGCGTGACGGCGCTGGAGCAGGGACTCGTACCGTAGCGGGGCAGGGCNNN
TGTCAGTGCCGCCGTGTGGtcagcggcgatCGGCG-GGTCGATGGGCCGCACCGGGTCAGCTGGGTGNAG
ACACGTGGCGATGACAGGCGGACAGATGGACAGGGTGGGAGGGCAGGGTGCAGGGCACAGAGGAGAGAGG
CCTTCAGGCTAGGTAGGCGCCCCCTCCCCATCCCGccccGTGTGCCCCGAGGGCCACTCACCCCGTGGGA
CGGTGAAGTAGCTTCG-GGCGTTGGGTCCAGCACTTGGCCACAGTGAGGCTGNAAATGGCTGCAGGAACG
GTGGTCCCCCCGCAAGGCCCCCATGGTCCCACCTCCCTGCCTGGCCCCTCCCGCTCCAGCGCCNCCAGCC

  • Skopiuj kod genetyczny do swojego skryptu i zapisz jako DNA = ACTG...
  • Policz ile razy występuje w kodzie każda zasada azotowa – adenina, cytozyna, guanina, tymina.

Na pewno zauważysz błędy sekwencjonowania – znaki, które nie są żadną z 4 zasad.
W panice szukasz pliku z dokumentacją. Ufff… znalazł się!
Co więcej, pojawił się zapis, że gdy jakość sekwencji nie pozwala dokładnie odczytać rodzaju zasady azotowej wstawiany jest znak „-” Natomiast, gdy laser zczytujący ześlizgnie się wstawiane są litery „N”, jednocześnie ostatnia wartość zasady jest ponownie zczytywana bez ubytku zasady w tym miejscu. Co za przydatna informacja!

  • Policz wystąpienia sekwencji GAGA i zamień je na AGAG
  • Znajdź miejsce (indeks) w łańcuchu, gdzie występuje 7 guanin pod rząd
  • Znajdź miejsce (indeks) , gdzie od końca łańcucha występuje 6 cytozyn
  • Policz ile razy w kodzie pojawiła się sekwencja CTGAAA
  • W sekwencji CTGAAA czasem mutuje ostania litera A, wówczas jakość ostatniej litery może być wątplia. Ile sekwencji znajdziesz, jeśli weźmiesz pod uwagę wątpliwą, ostatnią adeninę?
  • Oczyść DNA z wszystkich błędów. Na podstawie czystej nici utwórz odpowiadającą jej nić RNA (nić RNA w miejscu tyminy będzie mieć uracyl (U))

Tu pojawi się rozwiązanie zadań: <ale za tydzień, żeby nie było za łatwo 😉 >

Ten wpis należy do cyklu: Python kurs od podstaw